News
Purified RNA (100 ng) was added into a 10 µl total volume of real-time PCR mix buffer containing forward/reverse primer pairs (forward, AGCCTCTTCTCGTTCCTCATCAC; reverse, CCGCCATTGCCAGCCATTC; each 500 ...
Since 1959 the avian flu virus H5N1 has been popping up around the globe. Now scientists believe it could spark the next pandemic.
The world has just emerged from the COVID-19 pandemic, with vivid memories of the devastating impacts of the SARS-CoV-2 virus on human health, economies, and social stability in recent years.
3d
News-Medical.Net on MSNH5N1's evolutionary leap could undermine vaccines and heighten human infection riskFrom egg prices to pet food recalls – and now, confirmation that another strain of bird flu has infected a large commercial ...
1 SARS-CoV-2 strain causes fewer and less-severe short-term side effects than the Pfizer/BioNTech mRNA COVID-19 vaccine. The ...
The world has just emerged from the COVID-19 pandemic, with vivid memories of the devastating impacts of the SARS-CoV-2 virus on human health, economies, and social stability in recent years. Although ...
Abstract Background Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection and the resulting coronavirus disease 2019 (Covid-19) have afflicted tens of millions of people in a ...
Most recent smoking status was determined from primary care records (70.8%) and UK Biobank questionnaire data (29.2%). COVID-19 outcomes were derived from Public Health England SARS-CoV-2 testing ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results